Hamburger Menu Button
Thermo Fisher Scientific Logo
Sign in
Don't have an account ? Create Account
  • Products
    • Antibodies
    • Cell Culture Media
    • Chemicals
    • Chromatography Columns and Cartridges
    • Lab Equipment
    • Lab Plasticware and Supplies
    • Microplates
    • Oligos, Primers, Probes and Genes
    • TaqMan Real-Time PCR Assays
    • Greener Products
    • See all product categories
  • Applications
    • Bioprocessing
    • Cell Culture and Transfection
    • Cell and Gene Therapy
    • Chromatography
    • Molecular Testing
    • Digital Solutions
    • DNA and RNA Extraction and Analysis
    • Spectroscopy, Elemental and Isotope Analysis
    • See all applications and techniques
  • Services
    • 360° CDMO and CRO Solutions
    • CDMO Services
    • CRO Services
    • Custom Services
    • Enterprise Services
    • Financial and Leasing Services
    • Instrument Services
    • Lab Informatics
    • OEM and Commercial Supply
    • Training Services
    • Unity Lab Services
    • See all services
  • Help and Support
    • How to Order
    • Instrument Support
    • Learning Centers
    • Register for an Account
    • Technical Support Centers
    • See all help and support topics
  • Popular
    • TaqMan Real-Time PCR Assays
      TaqMan Real-Time PCR Assays
    • Antibodies
      Antibodies
    • Oligos, Primers & Probes
      Oligos, Primers & Probes
    • GeneArt Gene Synthesis
      GeneArt Gene Synthesis
    • Cell Culture Plastics
      Cell Culture Plastics
  • Contact Us
  • Quick Order
  • Order Status and Tracking
  • Documents and Certificates
Thermo Fisher Scientific Logo

Search Thermo Fisher Scientific

Search All
Search button Close
          • Order Status
          • Quick Order
          • Sign in
            Sign in
            Don't have an account ? Create Account
            • Account
            • Check Order Status
            • Aspire Member Program
            • Connect: Lab, Data, Apps
            • Custom Products & Projects
            • Services Central
          This product has been added to your favorites list. Go to My Favorites

          System Message

          OKCancel
          LOADING ...
          • Home
          • › Search Tool
          • › Search Results
          • › C___7515638_10
          See other CUTA GT Assays ›
          SNP ID:
          rs4231
          Gene
          CUTA KIFC1 PHF1 SYNGAP1
          Gene Name
          cutA divalent cation tolerance homolog (E. coli)
          kinesin family member C1
          PHD finger protein 1
          synaptic Ras GTPase activating protein 1
          Set Membership:
          > HapMap
          Chromosome Location:
          Chr.6: 33416197 - 33416197 on Build GRCh38
          Polymorphism:
          C/G, Transversion substitution
          Context Sequence [VIC/FAM]:

          AGCTGGGATGTACCTGGAGAGATAG[C/G]GGGTAGTTCTCCCTACTGCCCAGGC

          Assay ID C___7515638_10
          Size
          Availability Made To Order
          Catalog # 4351379
          Price
          Your Price
          Online offer:
          Check your price ›
          • Genomic Map
          • Assay Details
          • More Information

          Genomic Map

          LOADING...
          ×
          Back To Top

          Assay Details



          Species:

          Human

          dbSNP Submissions:

          NA

          Phenotype:

          MIM: 616953 MIM: 603763 MIM: 602881 MIM: 603384

          Literature Links:

          CUTA PubMed Links

          Allele Nomenclature:

          Minor Allele Frequency:

          1000Genome Applied Biosystems® HapMap
          Global
          G (0.05)
          (0.95)
          Caucasian - Not Available CEPH (CEU)
          G (0.12)
          (0.88)
          EAS
          G (0.02)
          (0.98)
          African American - Not Available YRI (Yoruba) - Not Available
          SAS
          G (0.06)
          (0.94)
          Chinese - Not Available JPT (Japanese)
          C (0.04)
          (0.96)
          AFR
          G (0.01)
          (0.99)
          Japanese - Not Available CHB (Han Chinese)
          G (0.01)
          (0.99)
          EUR
          C (0.11)
          (0.89)
          AMR
          G (0.09)
          (0.91)
          CUTA - cutA divalent cation tolerance homolog (E. coli)
          Transcript Accession SNP Location SNP Type Observed Codons Observed Amino Acid Protein ID
          NM_001014433.2 1860 Intron NP_001014433.1
          NM_001014837.1 1860 Intron NP_001014837.1
          NM_001014838.1 1860 Intron NP_001014838.1
          NM_001014840.1 1860 Intron NP_001014840.1
          NM_015921.2 1860 Intron NP_057005.1
          KIFC1 - kinesin family member C1
          There are no transcripts associated with this gene.
          PHF1 - PHD finger protein 1
          Transcript Accession SNP Location SNP Type Observed Codons Observed Amino Acid Protein ID
          NM_002636.4 1860 UTR 3 NP_002627.1
          NM_024165.2 1860 UTR 3 NP_077084.1
          XM_011514662.1 1860 UTR 3 XP_011512964.1
          XM_011514663.1 1860 UTR 3 XP_011512965.1
          XM_011514664.1 1860 UTR 3 XP_011512966.1
          XM_011514665.1 1860 UTR 3 XP_011512967.1
          XM_011514666.1 1860 UTR 3 XP_011512968.1
          XM_011514669.1 1860 UTR 3 XP_011512971.1
          XM_011514670.2 1860 Intron XP_011512972.1
          XM_017010939.1 1860 UTR 3 XP_016866428.1
          SYNGAP1 - synaptic Ras GTPase activating protein 1
          There are no transcripts associated with this gene.

          Back To Top

          More Information


          Set Membership:

          HapMap

          Panther Classification:

          Molecular Function -

          primary active transporter chromatin/chromatin-binding, or -regulatory protein

          Gene Ontology Categories:

          Function(s) Process(es)

          protein localization
          response to metal ion
          transcription, DNA-templated
          regulation of transcription, DNA-templated
          cellular response to DNA damage stimulus
          covalent chromatin modification
          negative regulation of gene expression, epigenetic
          negative regulation of histone H3-K27 methylation
          positive regulation of histone H3-K27 methylation
          copper ion binding
          protein binding
          enzyme binding
          transcription factor activity, sequence-specific DNA binding
          zinc ion binding
          methylated histone binding

          Back To Top

          Related Products

          • TaqMan® Genotyping Master Mix
          Ordering Plus Icon Minus Icon
          • Order Status
          • Order Help
          • Quick Order
          • Supply Center
          • eProcurement
          Support Plus Icon Minus Icon
          • Help and Support
          • Contact Us
          • Technical Support Centers
          • Documents and Certificates
          • Report a Site Issue
          Resources Plus Icon Minus Icon
          • Learning Centers
          • Promotions
          • Events and Webinars
          • Social Media
          About Thermo Fisher Plus Icon Minus Icon
          • About Us
          • Careers
          • Investors
          • News
          • Social Responsibility
          • Trademarks
          • Consumer Health Data Privacy Policy
          Our Portfolio Plus Icon Minus Icon
          • Thermo Scientific
          • Applied Biosystems
          • Invitrogen
          • Gibco
          • Ion Torrent
          • Fisher Scientific
          • Unity Lab Services
          • Patheon
          • PPD
          • Terms & Conditions
          • Privacy Information Center
          • Price & Freight Policy
          © 2006-2025 Thermo Fisher Scientific Inc. All rights reserved. All trademarks are the property of Thermo Fisher Scientific and its subsidiaries unless otherwise specified.
          United States flag icon
          United States

          Your items have has been added!


          Host server : magellan-search-666774c847-nqx77:80/100.66.134.75:80.
          git-commit: 4f7bff5b1d64937db6e1726f71785770340a1908
          git-url: https://github.com/thermofisher/magellan-search
          git-branch: release/2.34.0-2025.08.32-1.0