Hamburger Menu Button
Thermo Fisher Scientific Logo
Sign in
Don't have an account ? Create Account
  • Products
    • Antibodies
    • Cell Culture Media
    • Chemicals
    • Chromatography Columns and Cartridges
    • Lab Equipment
    • Lab Plasticware and Supplies
    • Microplates
    • Oligos, Primers, Probes and Genes
    • TaqMan Real-Time PCR Assays
    • Greener Products
    • See all product categories
  • Applications
    • Bioprocessing
    • Cell Culture and Transfection
    • Cell and Gene Therapy
    • Chromatography
    • Molecular Testing
    • Digital Solutions
    • DNA and RNA Extraction and Analysis
    • Spectroscopy, Elemental and Isotope Analysis
    • See all applications and techniques
  • Services
    • 360° CDMO and CRO Solutions
    • CDMO Services
    • CRO Services
    • Custom Services
    • Enterprise Services
    • Financial and Leasing Services
    • Instrument Services
    • Lab Informatics
    • OEM and Commercial Supply
    • Training Services
    • Unity Lab Services
    • See all services
  • Help and Support
    • How to Order
    • Instrument Support
    • Learning Centers
    • Register for an Account
    • Technical Support Centers
    • See all help and support topics
  • Popular
    • TaqMan Real-Time PCR Assays
      TaqMan Real-Time PCR Assays
    • Antibodies
      Antibodies
    • Oligos, Primers & Probes
      Oligos, Primers & Probes
    • GeneArt Gene Synthesis
      GeneArt Gene Synthesis
    • Cell Culture Plastics
      Cell Culture Plastics
  • Contact Us
  • Quick Order
  • Order Status and Tracking
  • Documents and Certificates
Thermo Fisher Scientific Logo

Search Thermo Fisher Scientific

Search All
Search button Close
          • Order Status
          • Quick Order
          • Sign in
            Sign in
            Don't have an account ? Create Account
            • Account
            • Check Order Status
            • Aspire Member Program
            • Connect: Lab, Data, Apps
            • Custom Products & Projects
            • Services Central
          This product has been added to your favorites list. Go to My Favorites

          System Message

          OKCancel
          LOADING ...
          • Home
          • › Search Tool
          • › Search Results
          • › C__12060045_20
          See other VDR GT Assays ›
          SNP ID:
          rs2228570
          Gene
          VDR
          Gene Name
          vitamin D (1,25- dihydroxyvitamin D3) receptor
          Set Membership:
          > HapMap
          Chromosome Location:
          Chr.12: 47879112 - 47879112 on Build GRCh38
          Polymorphism:
          A/G, Transition substitution
          Context Sequence [VIC/FAM]:

          GGAAGTGCTGGCCGCCATTGCCTCC[A/G]TCCCTGTAAGAACAGCAAGCAGGCC

          Assay ID C__12060045_20
          Size
          Availability Made To Order
          Catalog # 4351379
          Price
          Your Price
          Online offer:
          Check your price ›
          • Genomic Map
          • Assay Details
          • More Information

          Genomic Map

          LOADING...
          ×
          Back To Top

          Assay Details



          Species:

          Human

          dbSNP Submissions:

          NA

          Phenotype:

          MIM: 601769

          Literature Links:

          VDR PubMed Links

          Allele Nomenclature:

          Minor Allele Frequency:

          1000Genome Applied Biosystems® HapMap
          Global
          T (0.33)
          (0.67)
          Caucasian - Not Available CEPH (CEU)
          T (0.41)
          (0.59)
          EAS
          A (0.42)
          (0.58)
          African American - Not Available YRI (Yoruba)
          A (0.19)
          (0.81)
          SAS
          T (0.27)
          (0.73)
          Chinese - Not Available JPT (Japanese)
          A (0.33)
          (0.67)
          AFR
          T (0.19)
          (0.81)
          Japanese - Not Available CHB (Han Chinese)
          A (0.44)
          (0.56)
          EUR
          A (0.38)
          (0.62)
          AMR
          A (0.48)
          (0.52)
          VDR - vitamin D (1,25- dihydroxyvitamin D3) receptor
          Transcript Accession SNP Location SNP Type Observed Codons Observed Amino Acid Protein ID
          NM_000376.2 284 Missense Mutation AAG,AGG K,R 1 NP_000367.1
          NM_001017535.1 284 Missense Mutation AAG,AGG K,R 1 NP_001017535.1
          NM_001017536.1 284 Missense Mutation AAG,AGG K,R 51 NP_001017536.1
          XM_006719587.3 284 Missense Mutation AAG,AGG K,R 1 XP_006719650.1
          XM_011538720.2 284 Missense Mutation AAG,AGG K,R 1 XP_011537022.1

          Back To Top

          More Information


          Set Membership:

          HapMap

          Gene Ontology Categories:

          Function(s) Process(es)

          negative regulation of transcription from RNA polymerase II promoter
          cell morphogenesis
          skeletal system development
          transcription initiation from RNA polymerase II promoter
          calcium ion transport
          cellular calcium ion homeostasis
          signal transduction
          lactation
          negative regulation of cell proliferation
          positive regulation of gene expression
          negative regulation of keratinocyte proliferation
          positive regulation of vitamin D 24-hydroxylase activity
          bile acid signaling pathway
          steroid hormone mediated signaling pathway
          positive regulation of keratinocyte differentiation
          negative regulation of transcription, DNA-templated
          positive regulation of transcription from RNA polymerase II promoter
          decidualization
          intestinal absorption
          positive regulation of apoptotic process involved in mammary gland involution
          regulation of calcidiol 1-monooxygenase activity
          mammary gland branching involved in pregnancy
          vitamin D receptor signaling pathway
          DNA binding
          transcription factor activity, sequence-specific DNA binding
          steroid hormone receptor activity
          protein binding
          zinc ion binding
          calcitriol receptor activity
          lithocholic acid receptor activity
          sequence-specific DNA binding
          retinoid X receptor binding
          vitamin D response element binding
          calcitriol binding
          lithocholic acid binding

          Back To Top

          Related Products

          • TaqMan® Genotyping Master Mix
          Ordering Plus Icon Minus Icon
          • Order Status
          • Order Help
          • Quick Order
          • Supply Center
          • eProcurement
          Support Plus Icon Minus Icon
          • Help and Support
          • Contact Us
          • Technical Support Centers
          • Documents and Certificates
          • Report a Site Issue
          Resources Plus Icon Minus Icon
          • Learning Centers
          • Promotions
          • Events and Webinars
          • Social Media
          About Thermo Fisher Plus Icon Minus Icon
          • About Us
          • Careers
          • Investors
          • News
          • Social Responsibility
          • Trademarks
          • Consumer Health Data Privacy Policy
          Our Portfolio Plus Icon Minus Icon
          • Thermo Scientific
          • Applied Biosystems
          • Invitrogen
          • Gibco
          • Ion Torrent
          • Fisher Scientific
          • Unity Lab Services
          • Patheon
          • PPD
          • Terms & Conditions
          • Privacy Information Center
          • Price & Freight Policy
          © 2006-2025 Thermo Fisher Scientific Inc. All rights reserved. All trademarks are the property of Thermo Fisher Scientific and its subsidiaries unless otherwise specified.
          United States flag icon
          United States

          Your items have has been added!


          Host server : magellan-search-666774c847-nqx77:80/100.66.134.75:80.
          git-commit: 4f7bff5b1d64937db6e1726f71785770340a1908
          git-url: https://github.com/thermofisher/magellan-search
          git-branch: release/2.34.0-2025.08.32-1.0