Hamburger Menu Button
Thermo Fisher Scientific Logo
Sign in
Don't have an account ? Create Account
  • Products
    • Antibodies
    • Cell Culture Media
    • Chemicals
    • Chromatography Columns and Cartridges
    • Lab Equipment
    • Lab Plasticware and Supplies
    • Microplates
    • Oligos, Primers, Probes and Genes
    • TaqMan Real-Time PCR Assays
    • Greener Products
    • See all product categories
  • Applications
    • Bioprocessing
    • Cell Culture and Transfection
    • Cell and Gene Therapy
    • Chromatography
    • Molecular Testing
    • Digital Solutions
    • DNA and RNA Extraction and Analysis
    • Spectroscopy, Elemental and Isotope Analysis
    • See all applications and techniques
  • Services
    • 360° CDMO and CRO Solutions
    • CDMO Services
    • CRO Services
    • Custom Services
    • Enterprise Services
    • Financial and Leasing Services
    • Instrument Services
    • Lab Informatics
    • OEM and Commercial Supply
    • Training Services
    • Unity Lab Services
    • See all services
  • Help and Support
    • How to Order
    • Instrument Support
    • Learning Centers
    • Register for an Account
    • Technical Support Centers
    • See all help and support topics
  • Popular
    • TaqMan Real-Time PCR Assays
      TaqMan Real-Time PCR Assays
    • Antibodies
      Antibodies
    • Oligos, Primers & Probes
      Oligos, Primers & Probes
    • GeneArt Gene Synthesis
      GeneArt Gene Synthesis
    • Cell Culture Plastics
      Cell Culture Plastics
  • Contact Us
  • Quick Order
  • Order Status and Tracking
  • Documents and Certificates
Thermo Fisher Scientific Logo

Search Thermo Fisher Scientific

Search All
Search button Close
          • Order Status
          • Quick Order
          • Sign in
            Sign in
            Don't have an account ? Create Account
            • Account
            • Check Order Status
            • Aspire Member Program
            • Connect: Lab, Data, Apps
            • Custom Products & Projects
            • Services Central
          This product has been added to your favorites list. Go to My Favorites

          System Message

          OKCancel
          LOADING ...
          • Home
          • › Search Tool
          • › Search Results
          • › C_166593916_10
          See other DARS2 GT Assays ›
          SNP ID:
          rs145204276
          Gene
          DARS2 GAS5 GAS5-AS1 SNORA103 SNORD44 SNORD47 SNORD74 SNORD75 SNORD76 SNORD77 SNORD78 SNORD79 SNORD80 SNORD81 ZBTB37
          Gene Name
          aspartyl-tRNA synthetase 2, mitochondrial
          growth arrest specific 5 (non-protein coding)
          GAS5 antisense RNA 1
          small nucleolar RNA, H/ACA box 103
          small nucleolar RNA, C/D box 44
          small nucleolar RNA, C/D box 47
          small nucleolar RNA, C/D box 74
          small nucleolar RNA, C/D box 75
          small nucleolar RNA, C/D box 76
          small nucleolar RNA, C/D box 77
          small nucleolar RNA, C/D box 78
          small nucleolar RNA, C/D box 79
          small nucleolar RNA, C/D box 80
          small nucleolar RNA, C/D box 81
          zinc finger and BTB domain containing 37
          Set Membership:
          -
          Chromosome Location:
          Chr.1: 173868254 - 173868258 on Build GRCh38
          Polymorphism:
          AGGCA/-, Insertion/deletion
          Context Sequence [VIC/FAM]:

          GAGCAGAGAGGGGAGGGGGCGCG[AGGCA/-]AGGAAAGCTCTGGGGATGGGGGA

          Assay ID C_166593916_10
          Size
          Availability Made To Order
          Catalog # 4351379
          Price
          Your Price
          Online offer:
          Check your price ›
          • Genomic Map
          • Assay Details
          • More Information

          Genomic Map

          LOADING...
          ×
          Back To Top

          Assay Details



          Species:

          Human

          dbSNP Submissions:

          13 submissions

          Phenotype:

          MIM: 610956 MIM: 608280

          Literature Links:

          DARS2 PubMed Links

          Allele Nomenclature:

          Minor Allele Frequency:

          1000Genome Applied Biosystems® HapMap
          Global
          - (0.12)
          (0.88)
          Caucasian - Not Available CEPH (CEU) - Not Available
          EAS
          - (0.32)
          (0.68)
          African American - Not Available YRI (Yoruba) - Not Available
          SAS
          - (0.11)
          (0.89)
          Chinese - Not Available CHB (Han Chinese) - Not Available
          AFR
          - (0.03)
          (0.97)
          Japanese - Not Available JPT (Japanese) - Not Available
          EUR
          - (0.10)
          (0.90)
          AMR
          - (0.06)
          (0.94)
          DARS2 - aspartyl-tRNA synthetase 2, mitochondrial
          There are no transcripts associated with this gene.
          GAS5 - growth arrest specific 5 (non-protein coding)
          There are no transcripts associated with this gene.
          GAS5-AS1 - GAS5 antisense RNA 1
          There are no transcripts associated with this gene.
          SNORA103 - small nucleolar RNA, H/ACA box 103
          There are no transcripts associated with this gene.
          SNORD44 - small nucleolar RNA, C/D box 44
          There are no transcripts associated with this gene.
          SNORD47 - small nucleolar RNA, C/D box 47
          There are no transcripts associated with this gene.
          SNORD74 - small nucleolar RNA, C/D box 74
          There are no transcripts associated with this gene.
          SNORD75 - small nucleolar RNA, C/D box 75
          There are no transcripts associated with this gene.
          SNORD76 - small nucleolar RNA, C/D box 76
          There are no transcripts associated with this gene.
          SNORD77 - small nucleolar RNA, C/D box 77
          There are no transcripts associated with this gene.
          SNORD78 - small nucleolar RNA, C/D box 78
          There are no transcripts associated with this gene.
          SNORD79 - small nucleolar RNA, C/D box 79
          There are no transcripts associated with this gene.
          SNORD80 - small nucleolar RNA, C/D box 80
          There are no transcripts associated with this gene.
          SNORD81 - small nucleolar RNA, C/D box 81
          There are no transcripts associated with this gene.
          ZBTB37 - zinc finger and BTB domain containing 37
          Transcript Accession SNP Location SNP Type Observed Codons Observed Amino Acid Protein ID
          NM_001122770.1 160 Intron NP_001116242.1
          NM_032522.3 160 Intron NP_115911.1
          XM_005245546.2 160 Intron XP_005245603.1
          XM_006711578.3 160 UTR 5 XP_006711641.1
          XM_011510062.2 160 Intron XP_011508364.1
          XM_017002556.1 160 Intron XP_016858045.1
          XM_017002557.1 160 Intron XP_016858046.1
          XM_017002558.1 160 Intron XP_016858047.1

          Back To Top

          More Information


          Panther Classification:

          Molecular Function -

          C2H2 zinc finger transcription factor

          Gene Ontology Categories:

          Function(s) Process(es)

          transcription, DNA-templated
          regulation of transcription, DNA-templated
          DNA binding
          metal ion binding

          Back To Top

          Related Products

          • TaqMan® Genotyping Master Mix
          Ordering Plus Icon Minus Icon
          • Order Status
          • Order Help
          • Quick Order
          • Supply Center
          • eProcurement
          Support Plus Icon Minus Icon
          • Help and Support
          • Contact Us
          • Technical Support Centers
          • Documents and Certificates
          • Report a Site Issue
          Resources Plus Icon Minus Icon
          • Learning Centers
          • Promotions
          • Events and Webinars
          • Social Media
          About Thermo Fisher Plus Icon Minus Icon
          • About Us
          • Careers
          • Investors
          • News
          • Social Responsibility
          • Trademarks
          • Consumer Health Data Privacy Policy
          Our Portfolio Plus Icon Minus Icon
          • Thermo Scientific
          • Applied Biosystems
          • Invitrogen
          • Gibco
          • Ion Torrent
          • Fisher Scientific
          • Unity Lab Services
          • Patheon
          • PPD
          • Terms & Conditions
          • Privacy Information Center
          • Price & Freight Policy
          © 2006-2025 Thermo Fisher Scientific Inc. All rights reserved. All trademarks are the property of Thermo Fisher Scientific and its subsidiaries unless otherwise specified.
          United States flag icon
          United States

          Your items have has been added!


          Host server : magellan-search-666774c847-nqx77:80/100.66.134.75:80.
          git-commit: 4f7bff5b1d64937db6e1726f71785770340a1908
          git-url: https://github.com/thermofisher/magellan-search
          git-branch: release/2.34.0-2025.08.32-1.0